An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-87701-2'
ID   QT-EVE-GM-010; SV 0; linear; genomic DNA; STS; SYN; 89 BP.
XX
AC   MON-87701-2;
XX
DT   04-AUG-2011
DT   26-AGO-2011
XX
DE   Quantitative PCR method for detection of soybean event MON87701
DE   (Charels et al., 2011)
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event MON87701 (MON-87701-2)
XX
RN   [1]
RP   1-89
RA   Charels D. et al.,;
RT   "Event-specific Method for the Quantification of Soybean MON87701 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   EURL_GMFF=2011-01-18_MON 87701_EURLVL0509_validated_Method.pdf
RX   EURL_GMFF=2010-07-28_MON87701VR_EURLVL0509.pdf
XX
RN   [2]
RP   1-89
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QT-EVE-GM-010.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..89
FT                   /standard_name="PCR 89 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of soybean event MON87701 and the soybean host genome";
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: MON 87701 primer 2"
FT                   /note="TGGTGATATGAAGATACATGCTTAGCAT"
FT                   /target="5'-host genome"
FT   primer_bind     complement(35..64)
FT                   /standard_name="RT-PCR probe: MON 87701 probe"
FT                   /note="6-FAM-TCAGTGTTTGACACACACACTAAGCGTGCC-
FT                   TAMRA"
FT   primer_bind     complement(68..89)
FT                   /standard_name="Primer reverse: MON 87701 primer 1"
FT                   /note="CGTTTCCCGCCTTCAGTTTAAA"
FT                   /target="insert"
XX
SQ   Sequence 89 BP; 26 A; 16 C; 25 G; 22 T; 0 other;
     tggtgatatg aagatacatg cttagcatnn nnnnggcacg cttagtgtgt gtgtcaaaca        60
     ctgannnttt aaactgaagg cgggaaacg                                          89
//