An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MST-FG072-2'
ID   QT-EVE-GM-001; SV 0; linear; genomic DNA; STS; SYN; 70 BP.
XX
AC   MST-FG072-2;
XX
DT   18-JUN-2010
DT   16-AGO-2012
XX
DE   Quantitative PCR method for detection of soybean event FG72 (Savini et al., 2012)
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event FG72 (MST-FG072-2)
XX
RN   [1]
RP   1-70
RA   Savini C.,;
RT   "Event-specific Method for the Quantification of Soybean FG72 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2012).
RX   EURL_GMFF=EURL-VL-04 10 VR.pdf
RX   EURL_GMFF=EURL-VL-04-10 VP.pdf
XX
RN   [2]
RP   1-70
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-GM-001.pdf
XX
DR   GMOMETHODS;QT-TAX-GM-020;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..70
FT                   /standard_name="PCR 70 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3'integration border region (IBR) between the insert of soybean event FG72 and the soybean host genome";
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: MAE071"
FT                   /note="AGATTTGATCGGGCTGCAGG"
FT                   /target="insert"
FT   primer_bind     25..43
FT                   /standard_name="RT-PCR probe: TM325"
FT                   /note="FAM-AATGTGGTTCATCCGTCTT-MGBNFQ"
FT   primer_bind     complement(49..70)
FT                   /standard_name="Primer reverse: SHA097"
FT                   /note="GCACGTATTGATGACCGCATTA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 70 BP; 15 A; 12 C; 18 G; 25 T; 0 other;
     agatttgatc gggctgcagg nnnnaatgtg gttcatccgt cttnnnnnta atgcggtcat        60
     caatacgtgc                                                               70
//