ID QT-EVE-ZM-008; SV 0; linear; genomic DNA; STS; SYN; 108 BP. XX AC MON-00603-6; XX DT 21-NOV-2005 DT 04-NOV-2010 XX DE Quantitative PCR method for detection of maize event NK603 DE (Mazzara et al., 2005). XX KW event_specific. XX OS Zea mays (maize) - Event NK603 (MON-00603-6) XX RN [1] RP 1-108 RA Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2005). RX BSHOP=LBNA21825 XX RN [2] RP 1-108 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-008.pdf XX DR GMOMETHODS; QT-TAX-ZM-011; XX FH Key Location/Qualifiers FH FT STS 1..108 FT /standard_name="108 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome" FT primer_bind 1..27 FT /standard_name="Primer forward: NK603-F" FT /note="ATGAATGACCTCGAGTAAGCTTGTTAA" FT /target="insert" FT primer_bind 54..79 FT /standard_name="RT-PCR probe: NK603-PR" FT /note="FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA" FT primer_bind complement(81..108) FT /standard_name="Primer reverse: NK603-R" FT /note="AAGAGATAACAGGATCCACTCAAACACT" FT /target="3'-host genome" XX SQ Sequence 108 BP; 24 A; 28 C; 25 G; 31 T; 0 other; atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc 60 acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt 108 //