ID QT-EVE-ZM-006; SV 0; linear; genomic DNA; STS; SYN; 70 BP. XX AC SYN-BT011-1; XX DT 13-JUN-2006 DT 08-NOV-2010 XX DE Quantitative PCR method for detection of maize event Bt11 DE (Mazzara et al., 2005). THIS IS NOT THE OFFICIAL METHOD FOR Bt11 (SEE QT-EVE-ZM-015). XX KW event_specific. XX OS Zea mays (maize) - event Bt11 (SYN-BT011-1) XX RN [1] RP 1-70 RA Mazzara M., Puumalaainen J., Van Den Eede G.; RT "Validation of the GMO Specific Detection Method Developed by NVI/INRA for Bt11 in Sweet Corn Maize - Validation Report and Protocol"; RL Online Publication (2005). RX BSHOP=LBNA21829 XX RN [2] RP 1-70 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-70 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-006.pdf XX DR GMOMETHODS; QT-TAX-ZM-001; XX FH Key Location/Qualifiers FH FT STS 1..70 FT /standard_name="event-specific PCR amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome" FT primer_bind 1..20 FT /standard_name="Primer forward: Bt113JFor" FT /note="GCGGAACCCCTATTTGTTTA" FT /target="insert" FT primer_bind 28..54 FT /standard_name="RT-PCR probe: Bt113JFT" FT /note="FAM-AAATACATTCAAATATGTATCCGCTCA-TAMRA" FT primer_bind complement(51..70) FT /standard_name="Primer reverse: Bt113JRev" FT /note="TCCAAGAATCCCTCCATGAG" FT /target="3' junction" XX SQ Sequence 70 BP; 18 A; 13 C; 13 G; 26 T; 0 other; gcggaacccc tatttgttta nnnnnnnaaa tacattcaaa tatgtatccg ctcatggagg 60 gattcttgga 70 //