ID QT-EVE-ZM-023; SV 0; linear; genomic DNA; STS; SYN; 82 BP. XX AC SYN-EV176-9; XX DT 30-NOV-2011 DT 18-JAN-2021 XX DE Quantitative PCR method for detection of maize event Bt176 (verified by the EU-RL GMFF in the context of Commission Decision 2007/304/EC) XX KW event_specific, EU-RL_GMFF_in-house_verified. XX OS Zea mays (maize) - event Bt176 (SYN-EV176-9) XX RN [1] RP 1-82 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "In-house Validation of an Event-specific Method for the Quantification of Maize Bt176 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=Bt176_CRLVL1804_VR.pdf RX EURL_GMFF=Bt176_CRLVL1804_validated_Method.pdf XX RN [2] RP 1-82 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QT-EVE-ZM-023.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..82 FT /standard_name="PCR 82 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3'integration border region (IBR) between the insert of maize event Bt176 and the maize host genome"; FT primer_bind 1..18 FT /standard_name="Primer forward: Bt176 F" FT /note="GGCCGTGAACGAGCTGTT" FT /target="insert" FT primer_bind 26..47 FT /standard_name="RT-PCR probe: Bt176 Probe" FT /note="FAM-AGCAACCAGATCGGCCGACACC-TAMRA" FT primer_bind complement(58..82) FT /standard_name="Primer reverse: Bt176 R" FT /note="GGGAAGAAGCCTACATGTTTTCTAA" FT /target="3'-host genome" XX SQ Sequence 82 BP; 21 A; 26 C; 18 G; 17 T; 0 other; ggccgtgaac gagctgttnn nnnnnagcaa ccagatcggc cgacaccnnn nnnnnnntta 60 gaaaacatgt aggcttcttc cc 82 //