An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-ELE-00-009; SV 0; linear; genomic DNA; STS; SYN; 118 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   04-OCT-2010
XX
DE   Qualitative PCR method for detection of nopaline synthase terminator
DE   (Lipp et al.,2001).
XX
KW   element_specific.
XX
RN   [1]
RP   1-118
RA   Lipp M., Bluth A., Eyquem F., Kruse L., Schimmel H., Van den Eede G.,
RA   Anklam E.;
RT   "Validation of a method based on polymerase chain reaction for the
RT   detection of genetically modified organisms in various processed
RT   foodstuffs";
RL   Eur. Food Res. Technol. 212:497-504 (2001).
RX   DOI=10.1007/s002170000274
XX
RN   [2]
RP   1-118
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [3]
RP   1-118
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-ELE-00-009.pdf
XX
FH   Key             Location/Qualifiers
FH               
FT   STS             1..118
FT                   /standard_name="PCR 118 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: HA-nos118-f"
FT                   /note="GCATGACGTTATTTATGAGATGGG"
FT                   /target="T-nos"
FT   primer_bind     complement(95..118)
FT                   /standard_name="Primer reverse: HA-nos118-r"
FT                   /note="GACACCGCGCGCGATAATTTATCC"
FT                   /target="T-nos"
XX
SQ   Sequence 118 BP; 11 A; 7 C; 16 G; 14 T; 70 other;
     gcatgacgtt atttatgaga tgggnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnggataa attatcgcgc gcggtgtc         118
//