An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DAS-24236-5'
ID   QT-EVE-GH-001a; SV 0; linear; genomic DNA; STS; SYN; 111 BP.
XX
AC   DAS-24236-5;
XX
DT   08-APR-2009
DT   16-NOV-2010
XX
DE   Quantitative PCR method for detection of cotton event 281-24-236
DE   (Mazzara et al., 2006).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event 281-24-236 (DAS-24236-5)
XX
RN   [1]
RP   1-111
RA   Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.;
RT   "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds";
RL   Online Publication (2006).
RX   DOI=10.2788/32649
XX
RN   [2]
RP   1-111
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-001a.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-016;
DR   GMOMETHODS; QT-TAX-GH-021;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..111
FT                   /standard_name="PCR 111 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of cotton event 281-24-236 and the cotton host genome"
FT   primer_bind     1..25
FT                   /standard_name="Primer forward: 281-f1"
FT                   /note="CTCATTGCTGATCCATGTAGATTTC"
FT                   /target="insert"
FT   primer_bind     complement(32..64)
FT                   /standard_name="RT-PCR probe: 281-s2"
FT                   /note="FAM-TTGGGTTAATAAAGTCAGATTAGAGGGAGACAA-TAMRA"
FT   primer_bind     complement(92..111)
FT                   /standard_name="Primer reverse: 281-r2"
FT                   /note="GGACAATGCTGGGCTTTGTG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 111 BP; 19 A; 24 C; 9 G; 26 T; 33 other;
     ctcattgctg atccatgtag atttcnnnnn nttgtctccc tctaatctga ctttattaac        60
     ccaannnnnn nnnnnnnnnn nnnnnnnnnn ncacaaagcc cagcattgtc c                111
//