ID QT-EVE-ZM-002; SV 0; linear; genomic DNA; STS; SYN; 107 BP. XX AC SYN-05307-1; XX DT 24-MAY-2011 DT 03-FEB-2015 XX DE Quantitative PCR method for detection of maize event 5307(EURL GMFF, 2014). XX KW event_specific. XX OS Zea mays (maize) - event 5307 (SYN-05307-1) XX RN [1] RP 1-107 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2014). RX EURL_GMFF=EURL-VL-07-11VR_Maize 5307 final report.pdf RX EURL_GMFF=2014-12-05_VP_EURL-VL-07-11FINAL.pdf XX RN [2] RP 1-107 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QT-EVE-ZM-002.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..107 FT /standard_name="PCR 107 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="3' integration border region (IBR) between the insert of maize event 5307 and the maize host genome"; FT primer_bind 1..21 FT /standard_name="Primer forward: 5307i3' forward primer" FT /note="CATGGCCGTATCCGCAATGTG" FT /target="insert" FT primer_bind 54..82 FT /standard_name="RT-PCR probe: 5307i3'-s2 probe" FT /note="FAM-ACCACAATATACCCTCTTCCCTGGGCCAG-TAMRA" FT primer_bind complement(90..107) FT /standard_name="Primer reverse: 5307i3' reverse primer" FT /note="TGCACCCTTTGCCAGTGG" FT /target="3'-host genome" XX SQ Sequence 107 BP; 24 A; 29 C; 25 G; 29 T; 0 other; catggccgta tccgcaatgt gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaccacaa 60 tataccctct tccctgggcc agnnnnnnnc cactggcaaa gggtgca 107 //