An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-EVE-EC-001; SV 0; linear; unassigned DNA; STS; SYN; 90 BP.
XX
AC   ;
XX
DT   23-JUN-2008
DT   23-NOV-2017
XX
DE   Qualitative PCR method for detection of  E. coli K-12 event AG3139 (Mazzara et al., 2009).
XX
KW   event_specific.
XX
OS   Escherichia coli K-12 (bacteria) - event AG3139
XX
RN   [1]
RP   1-90
RA   Mazzara M., Foti N., Savini C., Bonfini L., Van den Eede G.;
RT   "Event-specific method for the detection of dried-killed bacterial biomass PT73 (TM) derived from E. coli GM strain AG3139 using real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/58900.
XX
RN   [2]
RP   1-90
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-EVE-EC-001.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..90
FT                   /standard_name="PCR 90 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of E. coli K-12 event AG3139 and the bacterial host genome";                 
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: TMD-For"
FT                   /note="AATACCGTTAAACGTAAATTCTTTTTCTTT"
FT                   /target="5'-host genome"
FT   primer_bind     33..68
FT                   /standard_name="RT-PCR probe: TMD-probe"
FT                   /note="FAM-AGATCGAGTATTCATTCGGTGTATTGATTCACTTGA-TAMRA"
FT   primer_bind     complement(71..90)
FT                   /standard_name="Primer reverse: TMD-Rev"
FT                   /note="TCCTCCCGGTTTTTTTCGTA"
FT                   /target="insert"
XX
SQ   Sequence 90 BP; 30 A; 13 C; 17 G; 30 T; 0 other;
     aataccgtta aacgtaaatt ctttttcttt nnagatcgag tattcattcg gtgtattgat        60
     tcacttgann tacgaaaaaa accgggagga                                         90
//