Only one hit for query 'id:QT-eve-ST*'
ID QT-EVE-ST-001; SV 0; linear; genomic DNA; STS; SYN; 134 BP. XX AC BPS-25271-9; XX DT 05-MAR-2010 DT 14-OCT-2010 XX DE Quantitative PCR method for detection of potato event EH92-527-1 DE (Savini et al., 2006). XX KW event_specific. XX OS Solanum tuberosum (potato) - event EH92-527-1 (BPS-25271-9) XX RN [1] RP 1-134 RA Savini C., Foti N., Mazzara M., Charles Delobel C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato"; RL Online Publication (2006). RX DOI=10.2788/30418 XX RN [2] RP 1-134 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ST-001.pdf XX DR GMOMETHODS; QT-TAX-ST-010; XX FH Key Location/Qualifiers FH FT STS 1..134 FT /standard_name="PCR 134 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of potato event EH92-527-1 and the potato host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: Event527-bf1" FT /note="GTGTCAAAACACAATTTACAGCA" FT /target="insert" FT primer_bind complement(86..110) FT /standard_name="RT-PCR probe: St527-S2" FT /note="FAM-AGATTGTCGTTTCCCGCCTTCAGTT-TAMRA" FT primer_bind complement(113..134) FT /standard_name="Primer reverse: St527-R1" FT /note="TCCCTTAATTCTCCGCTCATGA" FT /target="3'-host genome" XX SQ Sequence 134 BP; 59 A; 21 C; 28 G; 26 T; 0 other; gtgtcaaaac acaatttaca gcannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnaactg aaggcgggaa acgacaatct nntcatgagc 120 ggagaattaa ggga 134 //