ID QL-CON-00-015; SV 0; linear; genomic DNA; STS; SYN; 136 BP. XX AC ; XX DT 16-JUL-2013 DT 18-OCT-2021 XX DE Qualitative PCR method for detection of the junction between the CaMV35S promoter and the bar gene (verified by the EURL GMFF in the context of Commission Decision 2006/578/EC). XX KW construct_specific, EURL_GMFF_in-house_verified. XX OS Oryza sativa (rice). XX RN [1] RP 1-136 RA Bayer CropScience; RT "Grain testing method for detection of rice GM event LLRICE601 using RT-PCR protocols PGS0505 and PGS0476"; RL Online Publication (2006). RX CRL-DOC=P35S-bar sqRT-PCR - PGS0494-476 310806.pdf XX RN [2] RP 1-136 RA US Department of Agriculture; RT "Verification of the Bayer CropScience method for the detection of LL601 in rice using real-time PCR"; RL Online Publication (2006). RX CRL-DOC=35SBarRiceVerficationReportrev.pdf XX RN [3] RP 1-136 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Report on the Verification of a Construct-specific Detection Method for RT Identification of Rice GM-Events containing P35S::BAR using a Real-time RT PCR Assay"; RL Online Publication (2006). RX CRL-DOC=Verification Report 35S-BAR CRL.pdf XX RN [4] RP 1-136 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2006). RX PCR=QL-CON-00-015.pdf XX DR GMOMETHODS; QL-TAX-OS-002; XX FH Key Location/Qualifiers FH FT STS 1..136 FT /standard_name="PCR 136 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the phosphinothricin N-acetyl transferase (bar) gene from Streptomyces hygroscopicus" FT misc_feature 1..136 FT /note="The fragment size generated by the CaMV P-35S-bar PCR depends on the assembly of the two sequence elements and is varying in the different GM plant events" FT primer_bind 1..21 FT /standard_name="Primer forward: MDB498" FT /note="TATCCTTCGCAAGACCCTTCC" FT /target="CaMV P-35S" FT primer_bind 22..46 FT /standard_name="RT-PCR probe: TM099" FT /note="FAM-TCTATATAAGGAAGTTCATTTCATT-MGBNFQ" FT primer_bind complement(115..136) FT /standard_name="Primer reverse: DPA143" FT /note="ATGTCGGCCGGGCGTCGTTCTG" FT /target="bar gene" XX SQ Sequence 136 BP; 37 A; 41 C; 21 G; 37 T; 0 other; tatccttcgc aagacccttc ctctatataa ggaagttcat ttcattnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnncagaac 120 gacgcccggc cgacat 136 //