An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-TAX-BN-004; SV 0; linear; genomic DNA; STS; PLN; 219 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   17-JAN-2013
XX
DE   Qualitative PCR method for detection of oilseed rape high mobility group protein I/Y gene
DE   (Pan et al., 2007).
XX
KW   taxon_specific, validated_independently.
XX
OS   Brassica napus (oilseed rape)
XX
RN   [1]
RP   1-219
RA   Pan L., Zhang S., Yang L., Broll H., Tian F., Zhang D.;
RT   "Interlaboratory trial validation of an event-specific qualitative
RT   polymerase chain reaction-based detection method for genetically modified
RT   RT73 rapeseed";
RL   J AOAC Int 90:1639-1646 (2007).
RX   PUBMED; 18193742.
XX
RN   [2]
RP   1-219
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-TAX-BN-004.pdf
XX
DR   GMOMETHODS; QL-EVE-BN-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..219
FT                   /standard_name="PCR 219 bp amplicon"
FT                   /note="Taxon-specific PCR for oilseed rape"
FT                   /target="high mobility group protein I/Y (HMGa) gene"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: HMG-1"
FT                   /note="GGTCGTCCTCCTAAGGCGAAAG"
FT                   /target="HMGa"
FT   primer_bind     complement(201..219)
FT                   /standard_name="Primer reverse: HMG-2"
FT                   /note="GCAACCAACAGGCACCATC"
FT                   /target="HMGa"
XX
SQ   Sequence 219 BP; 48 A; 54 C; 86 G; 31 T; 0 other;
     ggtcgtcctc ctaaggcgaa agnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn gatggtgcct gttggttgc                              219
//