An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-BV-013; SV 0; linear; genomic DNA; STS; PLN; 118 BP.
XX
AC   ;
XX
DT   27-JUN-2008
DT   29-OCT-2010
XX
DE   Quantitative PCR method for detection of sugar beet glutamine synthetase GS2 gene
DE   (Mazzara et al., 2006).
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Beta vulgaris (sugar beet)
XX
RN   [1]
RP   1-118
RA   Mazzara M., Foti N., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Sugarbeet Line H7-1 Using Real-Time PCR - Validation Report and Protocol;
RL   Online Publication (2006).
RX   DOI=10.2788/32035
XX
RN   [2]
RP   1-118
RT   "See Cross-references below";
RL   Online Publication (2010).
XX
DR   GMOMETHODS; QT-EVE-BV-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..118
FT                   /gene="GNL2"
FT                   /standard_name="PCR 118 bp amplicon"
FT                   /note="taxon-specific RT-PCR for sugar beet"
FT                   /target="glutamine synthetase (GS2) gene"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: GluA3-F"
FT                   /note="GACCTCCATATTACTGAAAGGAAG"
FT                   /target="GS2"
FT   primer_bind     48..74
FT                   /standard_name="RT-PCR probe: GluD1"
FT                   /note="FAM-CTACGAAGTTTAAAGTATGTGCCGCTC-TAMRA"
FT   primer_bind     complement(96..118)
FT                   /standard_name="Primer reverse: GluA3-R"
FT                   /note="GAGTAATTGCTCCATCCTGTTCA"
FT                   /target="GS2"
XX
SQ   Sequence 118 BP; 24 A; 15 C; 17 G; 18 T; 44 other;
     gacctccata ttactgaaag gaagnnnnnn nnnnnnnnnn nnnnnnncta cgaagtttaa        60
     agtatgtgcc gctcnnnnnn nnnnnnnnnn nnnnntgaac aggatggagc aattactc         118
//