ID QL-CON-00-007; SV 0; linear; genomic DNA; STS; SYN; 83 BP. XX AC ; XX DT 04-AUG-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between a cry1A(b)/cry1A(c) fusion gene and DNA spacer sequences (Grohmann and Maede, 2009). XX KW construct_specific. XX OS Oryza sativa (rice) - event Bt63 XX RN [1] RP 1-83 RA Grohmann L., Maede D.; RT "Detection of genetically modified rice: collaborative validation study RT of a construct-specific real-time PCR method for detection of transgenic RT Bt rice"; RL Eur. Food Res. Technol. 228:497-500 (2009). RX DOI=10.1007/s00217-008-0964-1 XX RN [2] RP 1-83 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-007.pdf XX DR GMOMETHODS; QL-TAX-OS-003; XX FH Key Location/Qualifiers FH FT STS 1..83 FT /standard_name="PCR 83 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the cry1A(b)/cry1A(c) fusion gene and the DNA spacer sequences linking the fusion gene to the nopaline synthase terminator (T-nos)" FT primer_bind 1..25 FT /standard_name="Primer forward: T51F" FT /note="GACTGCTGGAGTGATTATCGACAGA" FT /target="cry1Ac" FT primer_bind 26..59 FT /standard_name="RT-PCR probe: T51p" FT /note="FAM-TCGAGTTCATTCCAGTTACTGCAACACTCGAG-TAMRA" FT primer_bind complement(60..83) FT /standard_name="Primer reverse: T51R" FT /note="AGCTCGGTACCTCGACTTATTCAG" FT /target="DNA spacer sequences" XX SQ Sequence 83 BP; 14 A; 9 C; 15 G; 11 T; 34 other; gactgctgga gtgattatcg acagannnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc 60 tgaataagtc gaggtaccga gct 83 //