An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-GM005-3'
ID   QT-EVE-GM-004; SV 0; linear; genomic DNA; STS; SYN; 64 BP.
XX
AC   ACS-GM005-3;
XX
DT   06-JUN-2007
DT   14-OCT-2010
XX
DE   Quantitative PCR method for detection of soybean event A2704-12
DE   (Mazzara et al., 2007).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event A2704-12 (ACS-GM005-3)
XX
RN   [1]
RP   1-64
RA   Mazzara M., Charles Delobel C., Grazioli E., Larcher S., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantification of Soybean Line A2704-12 Using Real-Time PCR- Validation Report and Protocol - Soybean Seeds Sampling and DNA Extraction";
RL   Online Publication (2007).
RX   DOI=10.2788/28149
XX
RN   [2]
RP   1-64
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GM-004.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-009;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..64
FT                   /standard_name="PCR 64 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="Junction region containing a 3' bla sequence and an inverted 5' bla sequence"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: KVM175"
FT                   /note="GCAAAAAAGCGGTTAGCTCCT"
FT                   /target="bla"
FT   primer_bind     23..43
FT                   /standard_name="RT-PCR probe: TM031"
FT                   /note="FAM-CGGTCCTCCGATCGCCCTTCC-TAMRA"
FT   primer_bind     complement(45..64)
FT                   /standard_name="Primer reverse: SMO001"
FT                   /note="ATTCAGGCTGCGCAACTGTT"
FT                   /target="pUC19"
XX
SQ   Sequence 64 BP; 14 A; 21 C; 14 G; 13 T; 2 other;
     gcaaaaaagc ggttagctcc tncggtcctc cgatcgccct tccnaacagt tgcgcagcct        60
     gaat                                                                     64
//