ID QT-EVE-GM-016; SV 0; linear; genomic DNA; STS; SYN; 87 BP. XX AC MON-87751-7; XX DT 30-SEP-2014 DT 11-SEP-2019 XX DE Quantitative PCR method for detection of soybean event MON87751 (EURL GMFF, 2016). XX KW event_specific. XX OS Glycine max (soybean) - event MON87751 (MON-87751-7) XX RN [1] RP 1-87 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-03-14-VR-Corrected-Version-1.pdf RX EURL_GMFF=EURL-VL-03-14-VP-Corrected-Version-1.pdf XX RN [2] RP 1-87 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QT-EVE-GM-016.pdf XX DR GMOMETHODS; QT-TAX-GM-002; XX FH Key Location/Qualifiers FH FT STS 1..87 FT /standard_name="PCR 87 bp amplicon" FT /note="Event-specific RT-PCR; FT /target="5' integration border region (IBR) between the insert of soybean event MON87751 and the soybean host genome"; FT primer_bind 1..30 FT /standard_name="Primer forward: MON 87751 primer 2" FT /note="CTAAATTGCTCTTTGGAGTTTATTTTGTAG" FT /target="5'-host genome" FT primer_bind complement(34..62) FT /standard_name="RT-PCR probe: MON 87751 probe" FT /note="FAM-TGACTGGAGATCTCCAAAGTGAGGGGAAA-TAMRA" FT primer_bind complement(64..87) FT /standard_name="Primer reverse: MON 87751 primer 1" FT /note="GGCCTAACTTTTGGTGTGATGATG" FT /target="insert" XX SQ Sequence 87 BP; 22 A; 21 C; 14 G; 30 T; 0 other; ctaaattgct ctttggagtt tattttgtag nnntttcccc tcactttgga gatctccagt 60 cancatcatc acaccaaaag ttaggcc 87 //