Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:ACS-BN008-2'
ID   QT-EVE-BN-001; SV 0; linear; genomic DNA; STS; SYN; 123 BP.
AC   ACS-BN008-2;
DT   21-FEB-2006
DT   08-NOV-2010
DE   Quantitative PCR method for detection of oilseed rape event T45
DE   (Charles Delobel et al., 2006).
KW   event_specific.
OS   Brassica napus (oilseed rape) - event T45 (ACS-BN008-2)
RN   [1]
RP   1-123
RA   Charles Delobel C., Bogni A., Mazzara M., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Oilseed Rape Line T45 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Oilseed Rape";
RL   Online Publication (2006).
RX   DOI=10.2788/30936
RN   [2]
RP   1-123
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-BN-001.pdf
FH   Key             Location/Qualifiers
FT   STS             1..123
FT                   /standard_name="PCR 123 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of oilseed rape event T45 and the oilseed rape host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: KVM172"
FT                   /note="CAATGGACACATGAATTATGC"
FT                   /target="5'-host genome"
FT   primer_bind     70..94
FT                   /standard_name="RT-PCR probe: TM026 probe"
FT   primer_bind     complement(103..123)
FT                   /standard_name="Primer reverse: MDB599"
FT                   /note="GACTCTGTATGAACTGTTCGC"
FT                   /target="insert"
SQ   Sequence 123 BP; 23 A; 16 C; 15 G; 13 T; 56 other;
     caatggacac atgaattatg cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnt agaggaccta acagaactcg ccgtnnnnnn nngcgaacag ttcatacaga       120
     gtc                                                                     123