An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-GM-013; SV 0; linear; genomic DNA; STS; SYN; 130 BP.
XX
AC   DAS-68416-4;
XX
DT   11-APR-2011
DT   21-AUG-2014
XX
DE   Quantitative PCR method for detection of soybean event DAS-68416-4 (Savini et al., 2014).
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event DAS-68416-4 (DAS-68416-4)
XX
RN   [1]
RP   1-130
RA   Savini C., Sacco M.G., Mazzara M., Kreysa J.;
RT   "Event-specific Method for the Quantification of Soybean DAS-68416-4 Using Real-time PCR. Validation Report and Validated Method";
RL   Online Publication (2014).
RX   DOI=10.2788/87396
XX
RN   [2]
RP   1-130
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QT-EVE-GM-013.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..130
FT                   /standard_name="PCR 130 bp amplicon"
FT                   /note="Event-specific RT-PCR;
FT                   /target="3' integration border region (IBR) between the insert of soybean event DAS-68416-4 and the soybean host genome";
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: DAS-68416-4_3f5" 
FT                   /note="GTACATTAAAAACGTCCGCAATGTGT"
FT                   /target="insert"
FT   primer_bind     29..50
FT                   /standard_name="RT-PCR probe: DAS-68416-4_3p3"
FT                   /note="FAM-TTAAGTTGTCTAAGCGTCAATA-MGBNFQ"
FT   primer_bind     complement (98..130)
FT                   /standard_name="Primer reverse: DAS-68416-4_3r3"
FT                   /note="GTTTAAGAATTAGTTCTTACAGTTTATTGTTAG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 130 BP; 51 A; 19 C; 11 G; 49 T; 0 other;
     gtacattaaa aacgtccgca atgtgtnntt aagttgtcta agcgtcaata nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnncta acaataaact gtaagaacta       120
     attcttaaac                                                              130
//