ID QL-CON-00-004; SV 0; linear; genomic DNA; STS; SYN; 211 BP. XX AC SYN-EV176-9; XX DT 23-JUN-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the CDPK promoter from maize and the synthetic cry1A(b) gene (ISO/FDIS 21569:2005). XX KW construct_specific. XX OS Zea mays (maize) - event Bt176 (SYN-EV176-9) XX RN [1] RP 1-211 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-211 RT "Detection of a genetic modification of maize (Zea mays L.) by RT amplification of the modified DNA sequence by means of the polymerase RT chain reaction (PCR) and hybridization of the PCR product with a DNA RT probe or restriction analysis of the PCR product, N. L 15.05-1"; RL Online Publication (2002). XX RN [3] RP 1-211 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-004.pdf XX DR GMOMETHODS; QL-TAX-ZM-003; XX FH Key Location/Qualifiers FH FT STS 1..212 FT /standard_name="PCR 212 bp amplicon" FT /note="Construct-specific PCR" FT /target="Junction region between the calcium-dependent protein kinase promoter (P-CDPK) from maize and the synthetic cry1A(b) gene" FT primer_bind 1..20 FT /standard_name="Primer forward: Cry03" FT /note="CTCTCGCCGTTCATGTCCGT" FT /target="P-CDPK" FT primer_bind complement(193..212) FT /standard_name="Primer reverse: Cry04" FT /note="GGTCAGGCTCAGGCTGATGT" FT /target="cry1A(b)" XX SQ Sequence 212 BP; 42 A; 81 C; 58 G; 31 T; 0 other; ctctcgccgt tcatgtccgt nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180 nnnnnnnnnn nnacatcagc ctgagcctga cc 212 //