Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'id:QT-eve-BV*'
ID   QT-EVE-ZM-017; SV 0; linear; genomic DNA; STS; SYN; 111 BP.
AC   REN-00038-3;
DT   09-MAR-2006
DT   27-OCT-2010
DE   Quantitative PCR method for detection of maize event LY038
DE   (Charles Delobel et al., 2008). 
KW   event_specific.
OS   Zea mays (maize) - event LY038 (REN-00038-3)
RN   [1]
RP   1-111
RA   Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43570
RN   [2]
RP   1-111
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-017.pdf
FH   Key             Location/Qualifiers
FT   STS             1..111
FT                   /standard_name="PCR 111 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event LYO38 and the maize host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: LY038 AF"
FT                   /note="TGGGTTCAGTCTGCGAATGTT"
FT                   /target="5'-host genome"
FT   primer_bind     61..84
FT                   /standard_name="RT-PCR probe: LY038 AP"
FT   primer_bind     complement(87..111)
FT                   /standard_name="Primer reverse: LY038 AR"
FT                   /note="AGGAATTCGATATCAAGCTTATCGA"
FT                   /target="insert"
SQ   Sequence 111 BP; 14 A; 12 C; 22 G; 22 T; 41 other;
     tgggttcagt ctgcgaatgt tnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     cgagcggagt ttatgggtcg acggnntcga taagcttgat atcgaattcc t                111