An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DAS-40278-9'
ID   QT-EVE-ZM-004; SV 0; linear; genomic DNA; STS; SYN; 98 BP.
XX
AC   DAS-40278-9;
XX
DT   15-NOV-2010
DT   23-AUG-2013
XX
DE   Quantitative PCR method for detection of maize event DAS-40278-9 (Savini et al., 2012).
XX
KW   event_specific. 
XX
OS   Zea mays (maize) - event DAS-40278-9 (DAS-40278-9)
XX
RN   [1]
RP   1-98
RA   Savini C., et al.;
RT   "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7";
RL   Online Publication (2012).
RX   DOI=10.2788/64013 
XX
RN   [2]
RP   1-98
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-ZM-004.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..98
FT                   /standard_name="PCR 98 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of maize event DAS-40278-9 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: DAS-40278-9_5'-f1"
FT                   /note="CACGAACCATTGAGTTACAATC"
FT                   /target="5'-host genome"
FT   primer_bind     complement(43..67)
FT                   /standard_name="RT-PCR probe: DAS-40278-9_5'-S2"
FT                   /note="FAM-CGTAGCTAACCTTCATTGTATTCCG-TAMRA"
FT   primer_bind     complement(76..98)
FT                   /standard_name="Primer reverse: DAS-40278-9_5'-r3"
FT                   /note="TGGTTCATTGTATTCTGGCTTTG"
FT                   /target="insert"
XX
SQ   Sequence 98 BP; 39 A; 23 C; 18 G; 18 T; 0 other;
     cacgaaccat tgagttacaa tcnnnnnnnn nnnnnnnnnn nncggaatac aatgaaggtt        60
     agctacgnnn nnnnncaaag ccagaataca atgaacca                                98
//