ID QT-EVE-GM-005; SV 0; linear; genomic DNA; STS; PLN; 84 BP. XX AC MON-04032-6; XX DT 18-APR-2005 DT 12-OCT-2010 XX DE Quantitative PCR method for detection of soybean event GTS-40-3-2 DE (Mazzara et al., 2007). XX KW event_specific. XX OS Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) XX RN [1] RP 1-84 RA Mazzara M., Munaro B., Larcher S., Grazioli E., Charles Delobel C., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Soybean Line 40-3-2 RT Using Real-time PCR - Validation Report and Protocol - Report on the RT Validation of a DNA Extraction Method for Soybean Seeds. RL Online Publication (2007). RX DOI=10.2788/61824 XX RN [2] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GM-005.pdf XX DR GMOMETHODS; QT-TAX-GM-002; XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of soybean event GTS 40-3-2 and the soybean host genome" FT primer_bind 1..31 FT /standard_name="Primer forward: 40-3-2 AF" FT /note="TTCATTCAAAATAAGATCATACATACAGGTT" FT /target="5'-host genome" FT primer_bind complement(49..63) FT /standard_name="RT-PCR probe: 40-3-2 AP" FT /note="FAM-CCTTTTCCATTTGGG-MGBNFQ" FT primer_bind complement(64..84) FT /standard_name="Primer reverse: 40-3-2 AR" FT /note="GGCATTTGTAGGAGCCACCTT" FT /target="insert" XX SQ Sequence 84 BP; 37 A; 15 C; 15 G; 17 T; 0 other; ttcattcaaa ataagatcat acatacaggt tnnnnnnnnn nnnnnnnncc caaatggaaa 60 aggaaggtgg ctcctacaaa tgcc 84 //