Only one hit for query 'id%3aQT-eve-BV*'
ID QL-ELE-00-017; SV 1; linear; genomic DNA; STD; VRT; 75 BP. XX AC ; XX DT 03-NOV-1982 DT 29-FEB-2016 XX DE Qualitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter (Barbau-Piednoir et al., 2014). XX KW element_specific. XX RN [1] RP 1-75 RA Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., RA Van den Bulcke M.; RT "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR RT Screening(CoSYPS)"; RL Food Analitical Methods 0:0-0 (201402 RX DOI=10.1007/s12161-014-9837-3 XX RN [2] RP 1-75 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-017.pdf XX DR GMOMETHODS; QL-TAX-BN-003; DR GMOMETHODS; QL-TAX-GM-001; DR GMOMETHODS; QL-TAX-ZM-002; DR GMOMETHODS; QL-PLN-00-006; XX FH Key Location/Qualifiers FH FT STS 1..75 FT /standard_name="PCR 75 bp amplicon" FT /note="element-specific PCR" FT /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)" FT primer_bind 1..23 FT /standard_name="Primer forward: 35S_N3Fwd" FT /note="AAAGCAAGTGGATTGATGTGATA" FT /target="CaMV P-35S" FT primer_bind complement(56..75) FT /standard_name="Primer reverse: 35S_N3Rev" FT /note="GGGTCTTGCGAAGGATAGTG" FT /target="CaMV P-35S" XX SQ Sequence 75 BP; 23 A; 20 C; 16 G; 16 T; 0 other; aaagcaagtg gattgatgtg atannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncacta 60 tccttcgcaa gaccc 75 //