An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QT-eve-BV*'
ID   QT-EVE-BV-001; SV 0; linear; genomic DNA; STS; SYN; 108 BP.
XX
AC   KM-000H71-4;
XX
DT   09-MAR-2009
DT   19-OCT-2010
XX
DE   Quantitative PCR method for detection of sugar beet event H7-1
DE   (Mazzara et al., 2006).
XX
KW   event_specific.
XX
OS   Beta vulgaris (sugar beet) -  event H7-1 (KM-000H71-4)
XX
RN   [1]
RP   1-108
RA   Mazzara M., Foti N., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Sugarbeet Line H7-1 Using Real-Time PCR - Validation Report and Protocol;
RL   Online Publication (2006).
RX   DOI=10.2788/32035
XX
RN   [2]
RP   1-108
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-BV-001.pdf
XX
DR   GMOMETHODS; QT-TAX-BV-013;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..108
FT                   /standard_name="PCR 108 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of sugar beet event H7-1 and the sugar beet host genome"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: H7PLT1"
FT                   /note="TGGGATCTGGGTGGCTCTAACT"
FT                   /target="5'-host genome"
FT   primer_bind     51..70
FT                   /standard_name="RT-PCR probe: ZRH7"
FT                   /note="FAM-AAGGCGGGAAACGACAATCT-TAMRA"
FT   primer_bind     complement(90..108)
FT                   /standard_name="Primer reverse: ZRH7-R2"
FT                   /note="AATGCTGCTAAATCCTGAG"
FT                   /target="insert"
XX
SQ   Sequence 108 BP; 16 A; 12 C; 18 G; 15 T; 47 other;
     tgggatctgg gtggctctaa ctnnnnnnnn nnnnnnnnnn nnnnnnnnnn aaggcgggaa        60
     acgacaatct nnnnnnnnnn nnnnnnnnnc tcaggattta gcagcatt                    108
//