Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-ELE-00-012; SV 0; linear; genomic DNA; STS; SYN; 82 BP.
XX
AC   ;
XX
DT   25-MAY-2009
DT   04-OCT-2010
XX
DE   Qualitative duplex PCR method for detection of Cauliflower Mosaic Virus 35S promoter and nopaline synthase terminator (partim CaMV P-35S)
DE   (Waiblinger et al., 2008).  
XX
KW   element_specific.
XX
RN   [1]
RP   1-82
RA   Waiblinger H.-U., Ernst B., Anderson A., Pietsch K.;
RT   "Validation and collaborative study of a P35S and T-nos duplex real-time
RT   PCR screening method to detect genetically modified organisms in food
RT   products";
RL   Eur. Food Res. Technol. 226:1221-1228 (2008).
RX   DOI=10.1007/s00217-007-0748-z
XX
RN   [2]
RP   1-82
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-ELE-00-012.pdf
XX
DR   GMOMETHODS; QL-ELE-00-015;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..82
FT                   /standard_name="PCR 82 bp amplicon"
FT                   /note="element-specific duplex RT-PCR"
FT                   /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)"
FT   primer_bind     1..18
FT                   /standard_name="Primer forward: 35S-FTM"
FT                   /note="GCCTCTGCCGACAGTGGT"
FT                   /target="CaMV P-35S"
FT   primer_bind     19..60
FT                   /standard_name="Probe: 35S-TMP-FAM"
FT                   /note="FAM-CAAAGATGGACCCCCACCCACG-BHQ1"
FT   primer_bind     complement(61..82)
FT                   /standard_name="Primer reverse: 35S-RTM"
FT                   /note="AAGACGTGGTTGGAACGTCTTC"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 82 BP; 8 A; 13 C; 10 G; 9 T; 42 other;
     gcctctgccg acagtggtnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     gaagacgttc caaccacgtc tt                                                 82
//