An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-ELE-00-006; SV 0; linear; genomic DNA; STS; SYN; 180 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   27-SEP-2010
XX
DE   Qualitative PCR  method for detection of nopaline synthase terminator
DE   (L 00.00-31, 1998). 
XX
KW   element_specific.
XX
RN   [1]
RP   1-180
RT   "Screening procedure for the detection of genetically modified DNA
RT   sequences in foods by identification of DNA sequences that frequently
RT   occur in genetically modified organisms. No. L 00.00-31";
RL   Online Publication (1998).
XX
RN   [2]
RP   1-180
RA   Lipp M., Brodmann P., Pietsch K., Pauwels J., Anklam E., Borchers T.,
RA   Braunschweiger G., Busch U., Eklund E., Eriksen F.D., Fagan J., Fellinger
RA   A., Gaugitsch H., Hayes D., Hertel C., Hortner H., Joudrier P., Kruse L.,
RA   Meyer R., Miraglia M., Muller W., Phillipp P., Popping B., Rentsch R.,
RA   Wurtz A., et al.;
RT   "IUPAC collaborative trial study of a method to detect genetically
RT   modified soy beans and maize in dried powder";
RL   J AOAC Int 82:923-928 (1999).
RX   PUBMED; 10490320.
XX
RN   [3]
RP   1-180
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-ELE-00-006.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..180
FT                   /standard_name="PCR 180 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: NOS-1"
FT                   /note="GAATCCTGTTGCCGGTCTTG"
FT                   /target="T-nos"
FT   primer_bind     complement(161..180)
FT                   /standard_name="Primer reverse: NOS-3"
FT                   /note="TTATCCTAGTTTGCGCGCTA"
FT                   /target="T-nos"
XX
SQ   Sequence 180 BP; 10 A; 9 C; 11 G; 10 T; 140 other;
     gaatcctgtt gccggtcttg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn tagcgcgcaa actaggataa       180
//