Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-IR604-5'
ID   QT-EVE-BN-013; SV 0; linear; genomic DNA; STD; SYN; 123 BP.
XX
AC   BPS-BFLFK-2;
XX
DT   01-SEP-2021
DT   19-AUG-2022
XX
DE   Quantitative PCR method for detection of oilseed rape event LBFLFK locus2 (EURL GMFF, 2022).
XX
KW   event_specific.
XX
OS   Brassica napus (rape) - event LBFLFK (BPS-BFLFK-2)
XX
RN   [1]
RP   1-123
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Oilseed Rape LBFLFK Locus1 and Locus2 Using Real-time PCR - Validation Report";  
RL   Online Publication (2022).
RX   EURL_GMFF=EURL-VL-02-19-VR.pdf
RX   EURL_GMFF=EURL-VL-02-19-VM.pdf
XX
RN   [2]
RP   1-123
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2022).
RX   PCR=QT-EVE-BN-013.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..123
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the
FT                   insert of oilseed rape event LBFLFK Locus2 and the
FT                   oilseed rape host genome"
FT   primer_bind     1..28
FT                   /standard_name="Primer forward: rightFST_ev1_loc2-f4"
FT                   /note="GATTGGTAATATGTAAATAACGGGATCC"
FT                   /target="5'-host genome"
FT   primer_bind     50..74
FT                   /standard_name="RT-PCR probe: rightFST_ev1_loc2-s1"
FT                   /note="FAM-CATCACACCAAAAGTTAGGCCCGAA-BHQ1"
FT   primer_bind     complement(104..123)
FT                   /standard_name="Primer reverse: rightFST_ev1_loc2-r1"
FT                   /note="GCGAATTTGGCCTGTAGACC"
FT                   /target="insert"
XX
SQ   Sequence 123 BP; 44 A; 24 C; 24 G; 31 T; 0 other;
     gattggtaat atgtaaataa cgggatccnn nnnnnnnnnn nnnnnnnnnc atcacaccaa        60
     aagttaggcc cgaannnnnn nnnnnnnnnn nnnnnnnnnn nnnggtctac aggccaaatt       120
     cgc                                                                     123
//