Only one hit for query 'ac%3ASYN-IR604-5'
ID QT-EVE-ZM-015; SV 0; linear; genomic DNA; STS; SYN; 68 BP. XX AC SYN-BT011-1; XX DT 29-NOV-2007 DT 22-NOV-2010 XX DE Quantitative PCR method for detection of maize event Bt11 DE (Charles Delobel et al., 2008). XX KW event_specific. XX OS Zea mays (maize) - event Bt11 (SYN-BT011-1) XX RN [1] RP 1-68 RA Charles Delobel C., Larcher S., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Event Bt11 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/4370 XX RN [2] RP 1-68 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-ZM-015.pdf XX DR GMOMETHODS; QT-TAX-ZM-014; XX FH Key Location/Qualifiers FH FT STS 1..68 FT /standard_name="PCR 68 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome" FT primer_bind 1..21 FT /standard_name="Primer forward: Bt11-ev-f1" FT /note="TGTGTGGCCATTTATCATCGA" FT /target="5'-host genome" FT primer_bind 23..51 FT /standard_name="RT-PCR probe: Bt11-ev-p1" FT /note="FAM-TTCCATGACCAAAATCCCTTAACGTGAGT-TAMRA" FT primer_bind complement(48..68) FT /standard_name="Primer reverse: Bt11-ev-r5" FT /note="CGCTCAGTGGAACGAAAACTC" FT /target="insert" XX SQ Sequence 68 BP; 15 A; 17 C; 13 G; 22 T; 1 other; tgtgtggcca tttatcatcg anttccatga ccaaaatccc ttaacgtgag ttttcgttcc 60 actgagcg 68 //