ID QL-CON-00-013; SV 0; linear; genomic DNA; STD; UNA; 90 BP. XX AC ; XX DT 26-FEB-2016 DT 26-FEB-2016 XX DE Qualitative PCR method for detection of the junction between the maize ubiquitin promoter and the modified cry1Ab/1Ac genes (Grohmann et al.,2015). XX KW construct_specific. XX OS Oryza sativa (rice) - KeFeng6. XX RN [1] RP 1-90 RA Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., RA Jit Randhawa G., Zur K.; RT "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products"; RL Accred Qual Assur 20:85-96 (2015). RX DOI=10.1007/s00769-015-1108-5 XX RN [3] RP 1-90 RT "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR"; RL BVL L 15.06-3:2013-08 (2013). RX BVL=bvl-l-1506-3/193413251 XX RN [3] RP 1-90 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2015). RX PCR=QL-CON-00-013.pdf XX DR GMOMETHODS; QL-TAX-OS-003; XX FH Key Location/Qualifiers FH FT STS 1..90 FT /standard_name="PCR 90 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the maize ubiquitin promoter (P-ubi) and the modified cry1Ab/1Ac genes" FT primer_bind 1..26 FT /standard_name="Primer forward: Pubi-F2" FT /note="ATTTGCTTGGTACTGTTTCTTTTGTC" FT /target="P-ubi" FT primer_bind 34..60 FT /standard_name="RT-PCR probe: Pubi-T2" FT /note="FAM-ACCCTGTTGTTTGGTGTTACTTCTGCA-NFQ" FT primer_bind complement(66..90) FT /standard_name="Primer reverse: Cry-rr-R" FT /note="TTGTTGTCCATGGATCCTCTAGAGT" FT /target="cry1Ab/Ac" XX SQ Sequence 90 BP; 16 A; 19 C; 21 G; 34 T; 0 other; atttgcttgg tactgtttct tttgtcnnnn nnnaccctgt tgtttggtgt tacttctgca 60 nnnnnactct agaggatcca tggacaacaa 90 //