ID QT-EVE-GH-010; SV 0; linear; genomic DNA; STS; SYN; 84 BP. XX AC MON-88701-3; XX DT 13-FEB-2013 DT 12-JUL-2016 XX DE Quantitative PCR method for detection of cotton event MON88701 (EURL GMFF, 2016). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event MON88701 (MON-88701-3) XX RN [1] RP 1-84 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton MON88701 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-01-13-VR.pdf RX EURL_GMFF=MON-88701-Validated-Method.pdf XX RN [2] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QT-EVE-GH-010.pdf XX DR GMOMETHODS; QT-TAX-GH-015; XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="3' integration border region (IBR) between the insert of cotton event MON88701 and the cotton host genome" FT primer_bind 1..25 FT /standard_name="Primer forward: MON 88701 primer 1" FT /note="CATACTCATTGCTGATCCATGTAGA" FT /target="insert" FT primer_bind 27..53 FT /standard_name="RT-PCR probe: MON 88701 probe" FT /note="FAM-TTCCCGGACATGAAGCCTTAATTCAAT-TAMRA" FT primer_bind complement(58..84) FT /standard_name="Primer reverse: MON 88701 primer 2" FT /note="AGTGTTAAACAAGTTATGTTCTAGAGC" FT /target="3'-host genome" XX SQ Sequence 84 BP; 25 A; 19 C; 12 G; 28 T; 0 other; catactcatt gctgatccat gtaganttcc cggacatgaa gccttaattc aatnnnngct 60 ctagaacata acttgtttaa cact 84 //