An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-EVE-ZM-001; SV 0; linear; genomic DNA; STS; SYN; 170 BP.
XX
AC   MON-00810-6;
XX
DT   23-JUN-2009
DT   23-SEP-2010
XX
DE   Qualitative PCR method for detection of maize event MON810
DE   (ISO/FDIS 21569:2005).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON810 (MON-00810-6)
XX
RN   [1]
RP   1-170
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [2]
RP   1-170
RT   "Detection of a genetic modification of maize (Zea mays L.) by
RT   amplification of the modified DNA sequence by means of the polymerase
RT   chain reaction (PCR) and hybridization of the PCR product with a DNA
RT   probe or restriction analysis of the PCR product, N. L 15.05-1";
RL   Online Publication (2002).
XX
RN   [3]
RP   1-170
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-EVE-ZM-001.pdf
XX
DR   GMOMETHODS; QL-TAX-ZM-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..170
FT                   /standard_name="PCR 170 bp amplicon"
FT                   /note="Event-specific PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event MON810 and the maize host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: VW01"
FT                   /note="TCGAAGGACGAAGGACTCTAACG"
FT                   /target="5'-host genome"
FT   primer_bind     complement(149..170)
FT                   /standard_name="Primer reverse: VW03"
FT                   /note="TCCATCTTTGGGACCACTGTCG"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 170 BP; 15 A; 10 C; 14 G; 6 T; 125 other;
     tcgaaggacg aaggactcta acgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnncg acagtggtcc caaagatgga                  170
//