ID QT-EVE-GH-012; SV 0; linear; genomic DNA; STD; SYN; 101 BP. XX AC SYN-IR102-7; XX DT 10-OCT-2016 DT 20-MAR-2020 XX DE Quantitative PCR method for detection of cotton event COT102 (EURL GMFF, 2020). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event COT102 (SYN-IR102-7) XX RN [1] RP 1-101 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Cotton COT102 Using Real-time PCR - Validation Report"; RL Online Publication (2020). RX EURL_GMFF=EURL-VL-05-16-VR.pdf RX EURL_GMFF=EURL-VL-05-16-VM.pdf XX RN [2] RP 1-101 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2020). RX PCR=QT-EVE-GH-012.pdf XX DR GMOMETHODS; QT-TAX-GH-022; DR GMOMETHODS; QT-TAX-GH-017; XX FH Key Location/Qualifiers FH FT STS 1..101 FT /standard_name="PCR 101 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="3' integration border region (IBR) between the insert of cotton event COT102 and the cotton host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: COT102_3_89F" FT /note="TCTCCGCTCATGATCAGATTGTC" FT /target="insert" FT primer_bind 27..59 FT /standard_name="RT-PCR probe: COT102_3_115T" FT /note="FAM- TCCCGCCTTCAGTTTAAACTATCAGTGTTTAAT-TAMRA" FT primer_bind complement(77..101) FT /standard_name="Primer reverse: COT102_3_181R" FT /note="CAGTAACAGTACAGTCGGTGTAGGG" FT /target="3'-host genome" XX SQ Sequence 101 BP; 23 A; 26 C; 16 G; 36 T; 0 other; tctccgctca tgatcagatt gtcnnntccc gccttcagtt taaactatca gtgtttaatn 60 nnnnnnnnnn nnnnnnccct acaccgactg tactgttact g 101 //