Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-TAX-ZM-004; SV 0; linear; genomic DNA; STD; PLN; 69 BP.
AC   ;
DT   22-DEC-2015
DT   14-JUL-2016
DE   Quantitative PCR method for detection of maize aldolase 1 gene.
KW   taxon_specific, validated_in_combination.
OS   Zea mays (maize)
RN   [1]
RP   1-69
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize VCO-01981-5 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RN   [2]
RP   1-69
RT   "See Cross-references below";
RL   Online Publication (2016).
FH   Key             Location/Qualifiers
FT   STS             1..69
FT                   /standard_name="PCR 69 bp amplicon"
FT                   /note="Taxon-specific RT-PCR for maize" 
FT                   /target="aldolase (ald1) gene"
FT                   WARNING: This primer set amplifies two amplicons if used
FT                   on the Z. mays genome as target."
FT   primer_bind     1..17
FT                   /standard_name="Primer forward: Aldolase primer F"
FT                   /note="AGGGAGGACGCCTCCCT"
FT                   /target="ald1"
FT   primer_bind     21..46
FT                   /standard_name="RT-PCR probe: Aldolase probe"
FT   variation       31
FT                   /gene="NM_001111866"
FT                   /note="G in the 2nd copy present on chromosome 8"
FT   primer_bind     48..69
FT                   /standard_name="Primer reverse: Aldolase primer R"
FT                   /note="ACCCTGTACCAGAAGACCAAGG"
FT                   /target="ald1"
FT   variation       64
FT                   /note="G in the 2nd copy present on chromosome 8"
SQ   Sequence 69 BP; 15 A; 19 C; 19 G; 16 T; 0 other;
     agggaggacg cctccctcct tgaggacatc aacaaaaggc ttgccatcct tggtcttctg        60
     gtacagggt                                                                69