An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-015; SV 0; linear; genomic DNA; STS; SYN; 68 BP.
XX
AC   SYN-BT011-1;
XX
DT   29-NOV-2007
DT   22-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event Bt11
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event Bt11 (SYN-BT011-1) 
XX
RN   [1]
RP   1-68
RA   Charles Delobel C., Larcher S., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Event Bt11 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/4370
XX
RN   [2]
RP   1-68
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-015.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..68
FT                   /standard_name="PCR 68 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: Bt11-ev-f1"
FT                   /note="TGTGTGGCCATTTATCATCGA"
FT                   /target="5'-host genome"
FT   primer_bind     23..51
FT                   /standard_name="RT-PCR probe: Bt11-ev-p1"
FT                   /note="FAM-TTCCATGACCAAAATCCCTTAACGTGAGT-TAMRA"
FT   primer_bind     complement(48..68)
FT                   /standard_name="Primer reverse: Bt11-ev-r5"
FT                   /note="CGCTCAGTGGAACGAAAACTC"
FT                   /target="insert"
XX
SQ   Sequence 68 BP; 15 A; 17 C; 13 G; 22 T; 1 other;
     tgtgtggcca tttatcatcg anttccatga ccaaaatccc ttaacgtgag ttttcgttcc        60
     actgagcg                                                                 68
//