An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-88302-9'
ID   QT-EVE-BN-010; SV 0; linear; genomic DNA; STS; SYN; 101 BP.
XX
AC   MON-88302-9;
XX
DT   13-SEP-2011
DT   03-DEC-2013
XX
DE   Quantitative PCR method for detection of oilseed rape event MON88302 (Savini et al., 2013).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape)- event MON88302 (MON-88302-9)
XX
RN   [1]
RP   1-101
RA   Savini C., et al.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   EURL_GMFF=EURL-VL-09-11-VR-MON88302.pdf
RX   EURL_GMFF=EURL-VL-09-11-VM-MON88302.pdf
XX
RN   [2]
RP   1-101
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QT-EVE-BN-010.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..101
FT                   /standard_name="PCR 101 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region (IBR) between the insert of oilseed rape event MON88302 and the oilseed rape host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: 88302QF"
FT                   /note="TCCTTGAACCTTATTTTATAGTGCACA"
FT                   /target="5'-host genome"
FT   primer_bind     36..65
FT                   /standard_name="RT-PCR probe: 88302QP"
FT                   /note="FAM-TAGTCATCATGTTGTACCACTTCAAACACT-TAMRA"
FT   primer_bind     complement(78..101)
FT                   /standard_name="Primer reverse: 88302QR"
FT                   /note="TCAGATTGTCGTTTCCCGCCTTCA"
FT                   /target="insert"
XX
SQ   Sequence 101 BP; 33 A; 21 C; 16 G; 31 T; 0 other;
     tccttgaacc ttattttata gtgcacannn nnnnntagtc atcatgttgt accacttcaa        60
     acactnnnnn nnnnnnntga aggcgggaaa cgacaatctg a                           101
//