An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-EVE-ZM-029; SV 0; linear; genomic DNA; STD; PLN; 97 BP.
AC   MON-87419-8;
DT   13-SEP-2019
DT   13-SEP-2019
DE   Quantitative PCR method for detection of maize event MON87419 (EURL GMFF, 2019).
KW   event_specific.
OS   Zea mays (maize) - event MON87419 (MON-87419-8).
RN   [1]
RP   1-97
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR";   
RL   Online Publication (2019).
RX   EURL_GMFF=EURL-VL-02_17_VR_MON87419.pdf
RX   EURL_GMFF=EURL-VL-02_17_VM_MON87419.pdf
RN   [2]
RP   1-97
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2019).
RX   PCR=QT-EVE-ZM-029.pdf
FH   Key             Location/Qualifiers
FT   STS             1..97
FT                   /standard_name="PCR 97 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region 
FT 				(IBR) between the insert of maize event MON87419 and the maize host genome";
FT   primer_bind     1..19
FT                   /standard_name="Primer forward: 87419 QF"
FT                   /note="CGGTCGCTGCCAGGTATTG"
FT                   /target="5'-host genome"
FT   primer_bind     21..46
FT                   /standard_name="RT-PCR probe: 87419 QP"
FT   primer_bind     complement(75..97)
FT                   /standard_name="Primer reverse: 87419 QR"
FT                   /note="CAGACCTCAATTGCGAGCTTTCT"
FT                   /target="insert"
SQ   Sequence 97 BP; 27 A; 22 C; 25 G; 23 T; 0 other;
     cggtcgctgc caggtattgn tgtgcgccag tcagcatcat cacaccnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnagaaag ctcgcaattg aggtctg                                 97