Only one hit for query 'ac:ACS-BN005-8'
ID QT-TAX-ZM-004; SV 0; linear; genomic DNA; STD; PLN; 69 BP. XX AC ; XX DT 22-DEC-2015 DT 14-JUL-2016 XX DE Quantitative PCR method for detection of maize aldolase 1 gene. XX KW taxon_specific, validated_in_combination. XX OS Zea mays (maize) XX RN [1] RP 1-69 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize VCO-01981-5 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-07-12-VR.pdf RX EURL_GMFF=EURL-VL-07-12-VP.pdf XX RN [2] RP 1-69 RT "See Cross-references below"; RL Online Publication (2016). XX DR GMOMETHODS; QT-EVE-ZM-001; XX FH Key Location/Qualifiers FH FT STS 1..69 FT /standard_name="PCR 69 bp amplicon" FT /note="Taxon-specific RT-PCR for maize" FT /target="aldolase (ald1) gene" FT WARNING: This primer set amplifies two amplicons if used FT on the Z. mays genome as target." FT primer_bind 1..17 FT /standard_name="Primer forward: Aldolase primer F" FT /note="AGGGAGGACGCCTCCCT" FT /target="ald1" FT primer_bind 21..46 FT /standard_name="RT-PCR probe: Aldolase probe" FT /note="VIC-TGAGGACATCAACAAAAGGCTTGCCA-TAMRA" FT variation 31 FT /gene="NM_001111866" FT /note="G in the 2nd copy present on chromosome 8" FT primer_bind 48..69 FT /standard_name="Primer reverse: Aldolase primer R" FT /note="ACCCTGTACCAGAAGACCAAGG" FT /target="ald1" FT variation 64 FT /note="G in the 2nd copy present on chromosome 8" XX SQ Sequence 69 BP; 15 A; 19 C; 19 G; 16 T; 0 other; agggaggacg cctccctcct tgaggacatc aacaaaaggc ttgccatcct tggtcttctg 60 gtacagggt 69 //