Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-BN005-8'
ID   QL-ELE-00-001; SV 0; linear; genomic DNA; STS; SYN; 195 BP.
XX
AC   ;
XX
DT   23-JUN-2009
DT   11-JAN-2018
XX
DE   Qualitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter
DE   (BVL L 00.00-31, 1998).
XX
KW   element_specific.
XX
RN   [1]
RP   1-195
RA   Collection of Official Methods under Article 35 of the German Federal Foods Act;
RT   "Screening procedure for the detection of genetically modified DNA
RT   sequences in foods by identification of DNA sequences that frequently
RT   occur in genetically modified organisms";
RL   Food Analysis, L 00.00-31, Beuth, Berlin Koln (1998).
XX
RN   [2]
RP   1-195
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-ELE-00-001.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..195
FT                   /standard_name="PCR 195 bp amplicon"
FT                   /note="element-specific PCR"
FT                   /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)"
FT   primer_bind     1..19
FT                   /standard_name="Primer forward: 35S-1"
FT                   /note="GCTCCTACAAATGCCATCA"
FT                   /target="CaMV P-35S"
FT   primer_bind     complement(176..195)
FT                   /standard_name="Primer reverse: 35S-2"
FT                   /note="GATAGTGGGATTGTGCGTCA"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 195 BP; 12 A; 15 C; 4 G; 8 T; 156 other;
     gctcctacaa atgccatcan nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnntgacg       180
     cacaatccca ctatc                                                        195
//