An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-BN005-8'
ID   QT-EVE-BN-002; SV 0; linear; genomic DNA; STS; SYN; 130 BP.
XX
AC   ACS-BN005-8;
XX
DT   31-MAY-2006
DT   04-NOV-2010
XX
DE   Quantitative PCR method for detection of oilseed rape event Ms8
DE   (Mazzara et al., 2007).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event Ms8 (ACS-BN005-8)
XX
RN   [1]
RP   1-130
RA   Mazzara M., Bogni A., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR - Validation Report and Protocol- Seeds Sampling and DNA Extraction of Oilseed Rape";
RL   Online Publication (2007).
RX   DOI=10.2788/33880 
XX
RN   [2]
RP   1-130
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-BN-002.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..130
FT                   /standard_name="PCR 130 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of oilseed rape event Ms8 and the oilseed rape host genome"
FT   primer_bind     1..31
FT                   /standard_name="Primer forward: KVM085"
FT                   /note="GTTAGAAAAAGTAAACAATTAATATAGCCGG"
FT                   /target="insert"
FT   primer_bind     52..79
FT                   /standard_name="RT-PCR probe: TM011"
FT                   /note="FAM-AATATAATCGACGGATCCCCGGGAATTC-TAMRA"
FT   primer_bind     complement(111..130)
FT                   /standard_name="Primer reverse: HCA048"
FT                   /note="GGAGGGTGTTTTTGGTTATC"
FT                   /target="3'-host genome"
FT   unsure          129..130
FT                   /old_locus_tag="'C' ?"
FT                   /note="According to Protocol PGS0319, Annex 2.2, Version
FT                   B provided by BayerCropScience this 'C' is not
FT                   demonstrated any more. It is not defined if it is just
FT                   excuded from the PCR amplicon/ rev-Primer or if its
FT                   existence is unclear!"
XX
SQ   Sequence 130 BP; 33 A; 18 C; 13 G; 15 T; 51 other;
     gttagaaaaa gtaaacaatt aatatagccg gnnnnnnnnn nnnnnnnnnn naatataatc        60
     gacggatccc cgggaattcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn gataaccaaa       120
     aacaccctcc                                                              130
//