ID QT-EVE-GH-005; SV 0; linear; genomic DNA; STS; SYN; 82 BP. XX AC MON-15985-7; XX DT 21-NOV-2005 DT 03-NOV-2010 XX DE Quantitative PCR method for detection of cotton event MON15985 DE (Savini et al., 2008). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event MON15985 (MON-15985-7) XX RN [1] RP 1-82 RA Savini C., Mazzara M., Munaro B., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line MON 15985 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/4378 XX RN [2] RP 1-82 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-005.pdf XX DR GMOMETHODS; QT-TAX-GH-015; XX FH Key Location/Qualifiers FH FT STS 1..82 FT /standard_name="PCR 82 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of cotton event 15985 and the cotton host genome" FT primer_bind 1..21 FT /standard_name="Primer forward: MON15985 primer 1" FT /note="GTTACTAGATCGGGGATATCC" FT /target="insert" FT primer_bind 31..60 FT /standard_name="RT-PCR probe: MON15985 Probe" FT /note="FAM-CCGCTCTAGAACTAGTGGATCTGCACTGAA-TAMRA" FT primer_bind complement(62..82) FT /standard_name="Primer reverse: MON15985 primer 2" FT /note="AAGGTTGCTAAATGGATGGGA" FT /target="3'-host genome" XX SQ Sequence 82 BP; 19 A; 23 C; 20 G; 20 T; 0 other; gttactagat cggggatatc cnnnnnnnnn ccgctctaga actagtggat ctgcactgaa 60 ntcccatcca tttagcaacc tt 82 //