An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:QL-PLN*'
ID   QL-PLN-00-007; SV 0; linear; genomic DNA; STS; PLN; 571 BP.
XX
AC   ;
XX
DT   05-MAY-2009
DT   26-AGO-2011
XX
DE   Qualitative PCR method for detection of chloroplast tRNA-Leu intron
DE   (ISO/FDIS 21569:2005).
XX
KW   plant_specific.
XX
RN   [1]
RP   1-571
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [2]
RP   1-571
RT   "Detection of a genetic modification of potatoes by amplification of the
RT   modified DNA sequence using the polymerase chain reaction (PCR) and
RT   hybridization of the PCR product with a DNA probe, No. L24.01-1";
RL   Online Publication (1997).
XX
RN   [3]
RP   1-571
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-PLN-00-007.pdf
XX
CC   A 500 bp to 600 bp DNA fragment is amplified  from the chloroplast tRNA
CC   gene of different plant species. The amplicon here described is amplified from a sample of Solanum tuberosum L.(potato)
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..571
FT                   /standard_name="PCR 571 bp amplicon"
FT                   /note="plant-specific PCR"
FT                   /target="chloroplast tRNA-Leu (trnL) intron"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: A1"
FT                   /note="CGAAATCGGTAGACGCTACG"
FT                   /target="trnL"
FT   primer_bind     complement(552..571)
FT                   /standard_name="Primer reverse: A2"
FT                   /note="GGGGATAGAGGGACTTGAAC"
FT                   /target="trnL"
XX
SQ   Sequence 571 BP; 216 A; 96 C; 109 G; 150 T; 0 other;
     cgaaatcggt agacgctacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       480
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       540
     nnnnnnnnnn ngttcaagtc cctctatccc c                                      571
//