Only one hit for query 'ac:MON-00863-5'
ID QL-CON-00-003; SV 0; linear; genomic DNA; STS; SYN; 189 BP. XX AC SYN-BT011-1; XX DT 23-JUN-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the intron 2 from the maize adh1 gene and the pat gene(ISO/FDIS 21569:2005). XX KW construct_specific. XX OS Zea mays (maize) - event Bt11 (SYN-BT011-1) XX RN [1] RP 1-189 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-189 RT "Detection of a genetic modification of maize (Zea mays L.) by RT amplification of the modified DNA sequence by means of the polymerase RT chain reaction (PCR) and hybridization of the PCR product with a DNA RT probe or restriction analysis of the PCR product, N. L 15.05-1"; RL Online Publication (2002). XX RN [3] RP 1-189 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-003.pdf XX DR GMOMETHODS; QL-TAX-ZM-003; XX FH Key Location/Qualifiers FH FT STS 1..189 FT /standard_name="PCR 189 bp amplicon" FT /note="Construct-specific PCR" FT /target="Junction region between the Intron 2 (IVS2) from the maize alcohol dehydrogenase 1 (adh1) gene and the phosphinothricin N-acetyltransferase (pat) gene" FT primer_bind 1..22 FT /standard_name="Primer forward: IVS2-2" FT /note="CTGGGAGGCCAAGGTATCTAAT" FT /target="IVS 2 adh1" FT primer_bind complement(168..189) FT /standard_name="Primer reverse: PAT-B" FT /note="GCTGCTGTAGCTGGCCTAATCT" FT /target="pat" XX SQ Sequence 189 BP; 40 A; 50 C; 50 G; 49 T; 0 other; ctgggaggcc aaggtatcta atnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnaga ttaggccagc 180 tacagcagc 189 //