An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-87705-6'
ID   QT-EVE-GM-003; SV 0; linear; genomic DNA; STS; SYN; 86 BP.
XX
AC   MON-87705-6;
XX
DT   02-FEB-2010
DT   07-FEB-2012
XX
DE   Quantitative PCR method for detection of soybean event MON87705 (Savini et al., 2012)
XX
KW   event_specific.
XX
OS   Glycine max (soybean) - event MON87705 (MON-87705-6)
XX
RN   [1]
RP   1-86
RA   Savini C.,;
RT   "Event-specific Method for the Quantification of Soybean MON87705 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2012).
RX   EURL_GMFF=2011-05-20_CRLVL0110 MON87705_VP.pdf
RX   EURL_GMFF=2011-05-20_CRLVL0110 MON87705_VR.pdf
XX
RN   [2]
RP   1-86
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-GM-003.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..86
FT                   /standard_name="PCR 86 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="3'integration border region (IBR) between the insert of soybean event MON87705 and the soybean host genome";
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: MON 87705 primer 1"
FT                   /note="TTCCCGGACATGAAGCCATTTAC"
FT                   /target="insert";
FT   primer_bind     29..58
FT                   /standard_name="RT-PCR probe:  MON 87705 probe"
FT                   /note="FAM-AAGAGACTCAGGGTGTTGTTATCACTGCGG-
FT                   TAMRA"
FT   primer_bind     complement(65..86)
FT                   /standard_name="Primer reverse: MON 87705 primer 2"
FT                   /note="ACAACGGTGCCTTGGCCCAAAG"
FT                   /target="3'-host genome";
XX
SQ   Sequence 86 BP; 18 A; 19 C; 24 G; 25 T; 0 other;
     ttcccggaca tgaagccatt tacnnnnnaa gagactcagg gtgttgttat cactgcggnn        60
     nnnnctttgg gccaaggcac cgttgt                                             86
//