ID QT-EVE-GH-002; SV 0; linear; genomic DNA; STS; SYN; 79 BP. XX AC ACS-GH001-3; XX DT 02-FEB-2007 DT 17-NOV-2010 XX DE Quantitative PCR method for detection of cotton event LLCotton25 DE (Mazzara et al., 2007). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event LLCotton25 (ACS-GH001-3) XX RN [1] RP 1-79 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT "Event-Specific Method for the Quantification of Cotton Line "LLCotton25" Using Real-time PCR - Validation Report and Protocol - Cotton Seeds Sampling and DNA Extraction"; RL Online Publication (2007). RX DOI=10.2788/32755 XX RN [2] RP 1-79 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-002.pdf XX DR GMOMETHODS; QT-TAX-GH-018; XX FH Key Location/Qualifiers FH FT STS 1..79 FT /standard_name="PCR 79 bp amplicon" FT /note="event-specific RT-PCR" FT /target="5' integration border region (IBR) between the insert of cotton event LLCotton25 and the cotton host genome" FT primer_bind 1..20 FT /standard_name="Primer forward: KVM156" FT /note="CAAGGAACTATTCAACTGAG" FT /target="5'-host genome" FT primer_bind 21..46 FT /standard_name="RT-PCR probe: TM018" FT /note="FAM-CTTAACAGTACTCGGCCgTCGACCGC-TAMRA" FT primer_bind complement(56..79) FT /standard_name="Primer reverse: KVM155" FT /note="CAGATTTTTGTGGGATTGGAATTC" FT /target="insert" XX SQ Sequence 79 BP; 24 A; 25 C; 15 G; 15 T; 0 other; caaggaacta ttcaactgag cttaacagta ctcggccgtc gaccgcnnnn nnnnngaatt 60 ccaatcccac aaaaatctg 79 //