ID QT-EVE-GH-001a; SV 0; linear; genomic DNA; STS; SYN; 111 BP. XX AC DAS-24236-5; XX DT 08-APR-2009 DT 16-NOV-2010 XX DE Quantitative PCR method for detection of cotton event 281-24-236 DE (Mazzara et al., 2006). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event 281-24-236 (DAS-24236-5) XX RN [1] RP 1-111 RA Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; RT "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds"; RL Online Publication (2006). RX DOI=10.2788/32649 XX RN [2] RP 1-111 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-001a.pdf XX DR GMOMETHODS; QT-TAX-GH-016; DR GMOMETHODS; QT-TAX-GH-021; XX FH Key Location/Qualifiers FH FT STS 1..111 FT /standard_name="PCR 111 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of cotton event 281-24-236 and the cotton host genome" FT primer_bind 1..25 FT /standard_name="Primer forward: 281-f1" FT /note="CTCATTGCTGATCCATGTAGATTTC" FT /target="insert" FT primer_bind complement(32..64) FT /standard_name="RT-PCR probe: 281-s2" FT /note="FAM-TTGGGTTAATAAAGTCAGATTAGAGGGAGACAA-TAMRA" FT primer_bind complement(92..111) FT /standard_name="Primer reverse: 281-r2" FT /note="GGACAATGCTGGGCTTTGTG" FT /target="3'-host genome" XX SQ Sequence 111 BP; 25 A; 36 C; 13 G; 37 T; 0 other; ctcattgctg atccatgtag atttcnnnnn nttgtctccc tctaatctga ctttattaac 60 ccaannnnnn nnnnnnnnnn nnnnnnnnnn ncacaaagcc cagcattgtc c 111 //