An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-CON-00-005; SV 0; linear; genomic DNA; STS; SYN; 149 BP.
XX
AC   ACS-ZM003-2;
XX
DT   15-SEP-2009
DT   05-OCT-2016
XX
DE   Quantitative PCR method for detection of the junction between the phosphinothricin N-acetyltransferase gene and the CaMV 35S terminator.
XX
KW   construct_specific.
XX
OS   Zea mays (maize) - event T25 (ACS-ZM003-2)
XX
RN   [1]
RP   1-149
RA   Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J.,
RA   Akiyama H., Goda Y., Toyoda M., Hino A.;
RT   "Validation of real-time PCR analyses for line-specific quantitation of
RT   genetically modified maize and soybean using new reference molecules";
RL   J AOAC Int 85:1119-1126 (2002).
RX   PUBMED; 12374412.
XX
RN   [2]
RP   1-149
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Quantitative nucleic acid based
RT   methods";
RL   ISO 21570:1-103 (2005).
RX   ISO=34615
XX
RN   [3]
RP   1-149
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-CON-00-005.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-006;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..149
FT                   /standard_name="PCR 149 bp amplicon"
FT                   /note="Construct-specific RT-PCR"
FT                   /target="Junction region between the phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes and the Cauliflower Mosaic Virus 35S terminator (CaMV T-35S)"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: T25 1-5'"
FT                   /note="GCCAGTTAGGCCAGTTACCCA"
FT                   /target="pat"
FT   primer_bind     22..125
FT                   /standard_name="RT-PCR probe: T25-2-Taq"
FT                   /note="FAM-TGCAGGCATGCCCGCTGAAATC-TAMRA"
FT   primer_bind     complement(126..149)
FT                   /standard_name="Primer reverse: T25 1-3'"
FT                   /note="TGAGCGAAACCCTATAAGAACCCT"
FT                   /target="CaMV T-35S"
XX
SQ   Sequence 149 BP; 9 A; 11 C; 12 G; 13 T; 104 other;
     gccagttagg ccagttaccc annnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnagggt tcttataggg tttcgctca                                         149
//