An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-E3272-5'
ID   QT-EVE-ZM-019; SV 0; linear; genomic DNA; STS; SYN; 95 BP.
XX
AC   SYN-E3272-5;
XX
DT   25-AUG-2009
DT   05-FEB-2015
XX
DE   Quantitative PCR method for detection of maize event 3272
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event 3272 (SYN-E3272-5)
XX
RN   [1]
RP   1-95
RA   Charles Delobel C., Foti N., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43051
XX
RN   [2]
RP   1-95
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-019.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..95
FT                   /standard_name="PCR 95 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event 3272 and the maize host genome"
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: ES3272-F"
FT                   /note="TCATCAGACCAGATTCTCTTTTATGG"
FT                   /target="5'-host genome"
FT   primer_bind     47..69
FT                   /standard_name="RT-PCR probe: ES3272-P"
FT                   /note="FAM-ACTGCTGACGCGGCCAAACACTG-TAMRA"
FT   primer_bind     complement(76..95)
FT                   /standard_name="Primer reverse: ES3272-R"
FT                   /note="CGTTTCCCGCCTTCAGTTTA"
FT                   /target="insert"
XX
SQ   Sequence 95 BP; 20 A; 17 C; 17 G; 15 T; 26 other;
     tcatcagacc agattctctt ttatggnnnn nnnnnnnnnn nnnnnnactg ctgacgcggc        60
     caaacactgn nnnnntaaac tgaaggcggg aaacg                                   95
//