Only one hit for query 'ac%3aMON-89788-1'
ID QT-CON-00-002; SV 0; linear; genomic DNA; STS; SYN; 88 BP. XX AC MON-04032-6; XX DT 29-MAY-2009 DT 06-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the CTP sequence and the CP4 epsps gene (Hird et al., 2003). XX KW construct_specific. XX OS Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) XX RN [1] RP 1-88 RA Hird H., Powell J., Johnson M.L., Oehlschlager S.; RT "Determination of percentage of RoundUp Ready soya in soya flour using RT real-time polymerase chain reaction: interlaboratory study"; RL J AOAC Int 86:66-71 (2003). RX PUBMED; 12607742. XX RN [2] RP 1-88 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-002.pdf XX DR GMOMETHODS; QT-TAX-GM-004; XX FH Key Location/Qualifiers FH FT STS 1..88 FT /standard_name="PCR 88 bp amplicon" FT /note="Construct-specific duplex RT-PCR" FT /target="Junction region between the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene and the CP4 epsps gene from Agrobacterium tumefasciens" FT primer_bind 1..23 FT /standard_name="Primer forward: RR-F" FT /note="GGATTTCAGCATCAGTGGCTACA" FT /target="CTP4" FT primer_bind complement(33..53) FT /standard_name="RT-PCR probe: RR soya" FT /note="FAM-CCGGCTGCTTGCACCGTGAAG-TAMRA" FT primer_bind complement(71..88) FT /standard_name="Primer reverse: RR-R" FT /note="CCGGAAAGGCCAGAGGAT" FT /target="CP4-EPSPS" XX SQ Sequence 88 BP; 16 A; 32 C; 23 G; 17 T; 0 other; ggatttcagc atcagtggct acannnnnnn nncttcacgg tgcaagcagc cggnnnnnnn 60 nnnnnnnnnn atcctctggc ctttccgg 88 //