European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:SYN-E3272-5'
ID   QT-EVE-ZM-019; SV 0; linear; genomic DNA; STS; SYN; 95 BP.
XX
AC   SYN-E3272-5;
XX
DT   25-AUG-2009
DT   05-FEB-2015
XX
DE   Quantitative PCR method for detection of maize event 3272
DE   (Charles Delobel et al., 2008).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event 3272 (SYN-E3272-5)
XX
RN   [1]
RP   1-95
RA   Charles Delobel C., Foti N., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Event 3272 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43051
XX
RN   [2]
RP   1-95
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-019.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..95
FT                   /standard_name="PCR 95 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event 3272 and the maize host genome"
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: ES3272-F"
FT                   /note="TCATCAGACCAGATTCTCTTTTATGG"
FT                   /target="5'-host genome"
FT   primer_bind     47..69
FT                   /standard_name="RT-PCR probe: ES3272-P"
FT                   /note="FAM-ACTGCTGACGCGGCCAAACACTG-TAMRA"
FT   primer_bind     complement(76..95)
FT                   /standard_name="Primer reverse: ES3272-R"
FT                   /note="CGTTTCCCGCCTTCAGTTTA"
FT                   /target="insert"
XX
SQ   Sequence 95 BP; 20 A; 17 C; 17 G; 15 T; 26 other;
     tcatcagacc agattctctt ttatggnnnn nnnnnnnnnn nnnnnnactg ctgacgcggc        60
     caaacactgn nnnnntaaac tgaaggcggg aaacg                                   95
//