ID QL-TAX-LU-001; SV 1; linear; genomic DNA; STD; PLN; 68 BP. XX AC ; XX DT 28-NOV-2012 DT 01-DEC-2016 XX DE Qualitative PCR method for detection of flax stearoyl-acyl carrier protein desaturase gene XX KW taxon_specific, validated_in_combination. XX OS Linum usitatissimum (flax) XX RN [1] RP 1-68 RA Grohmann L., Busch U., Pecoraro S., Hess N., Pietsch K., Mankertz J.; RT "Collaborative trial validation of a construct-specific real-time PCR RT method for detection of genetically modified linseed event 'CDC Triffid' RT FP967"; RL Eur Food Res Technol 232:557-561 (2011). RX DOI=10.1007/s00217-010-1403-7 XX RN [2] RP 1-68 RT "Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products"; RL ISO/TS 21569-2:1-9 (2012). RX ISO=60166 XX RN [3] RP 1-68 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Report on the Verification of the Performance of a Construct-Specific Assay for the Detection of Flax CDC Triffid Event FP967 Using Real-Time PCR "; RL Online Publication (2009). RX CRL-DOC=Flax-CDCTriffidFlaxJRC091030.pdf RX CRL-DOC=Flax_FP967_verification_report.pdf XX RN [4] RP 1-68 RT "See Cross-references below"; RL Online Publication (2016). XX DR GMOMETHODS; QL-CON-00-010; XX FH Key Location/Qualifiers FH FT STS 1..68 FT /standard_name="PCR 68 bp amplicon" FT /note="taxon-specific RT-PCR for flax" FT /target="stearoyl-acyl carrier protein desaturase (sad) gene" FT primer_bind 1..20 FT /standard_name="Primer forward: SAD FW primer" FT /note="GCTCAACCCAGTCACCACCT" FT /target="sad" FT primer_bind complement(21..44) FT /standard_name="RT-PCR probe: SAD probe" FT /note="FAM-TGTTGAGGGAGCGTGTTGAAGGGA-BHQ" FT misc_difference 28..31 FT /note="A mismatch of two nucleotides at position 28 (G instead of A) and 31 (C instead of A) is present between the probe sequence and a variant of the sad gene (sad2) with GenBank accession number AJ006958(position 173 and 176 of the gene sequence), a perfect match can be observed instead with the sad gene having GenBank accession number X70962" FT primer_bind complement(49..68) FT /standard_name="Primer reverse: SAD RV primer" FT /note="TGCGAGGAGATCTGGAGGAG" FT /target="sad" XX SQ Sequence 68 BP; 15 A; 33 C; 5 G; 15 T; 0 other; gctcaaccca gtcaccacct tcccttcaac acgctccctc aacannnnct cctccagatc 60 tcctcgca 68 //