An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:MON-00863-5'
ID   QT-EVE-ZM-009; SV 0; linear; genomic DNA; STS; SYN; 84 BP.
AC   MON-00863-5;
DT   19-FEB-2010
DT   03-NOV-2010
DE   Quantitative PCR method for detection of maize event MON863
DE   (Mazzara et al., 2005).
KW   event_specific.
OS   Zea mays (maize) - event MON863 (MON-00863-5)
RN   [1]
RP   1-84
RA   Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line MON 863 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2005).
RN   [2]
RP   1-84
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-009.pdf
FH   Key             Location/Qualifiers
FT   STS             1..84
FT                   /standard_name="PCR 84 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event MON 863 and the maize host genome"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: MON863 primer F"
FT                   /note="TGTTACGGCCTAAATGCTGAACT"
FT                   /target="5'-host genome"
FT   primer_bind     complement(26..53)
FT                   /standard_name="RT-PCR probe: MON863 Probe"
FT   primer_bind     complement(63..84)
FT                   /standard_name="Primer reverse: MON863 primer R"
FT                   /note="GTAGGATCGGAAAGCTTGGTAC"
FT                   /target="insert"
SQ   Sequence 84 BP; 15 A; 19 C; 16 G; 23 T; 11 other;
     tgttacggcc taaatgctga actnntgacc ctacttgttc ggatgggtgt tcannnnnnn        60
     nngtaccaag ctttccgatc ctac                                               84